Text Generation
Transformers
PyTorch
loleve
genomics
dna
language-model
causal-lm
biology
sequence-modeling
variant-prediction
promoter
indel
eqtl
custom_code
Instructions to use Marks-lab/LOL-EVE with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use Marks-lab/LOL-EVE with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("text-generation", model="Marks-lab/LOL-EVE", trust_remote_code=True)# Load model directly from transformers import AutoModelForCausalLM model = AutoModelForCausalLM.from_pretrained("Marks-lab/LOL-EVE", trust_remote_code=True, device_map="auto") - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use Marks-lab/LOL-EVE with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "Marks-lab/LOL-EVE" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker
docker model run hf.co/Marks-lab/LOL-EVE
- SGLang
How to use Marks-lab/LOL-EVE with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "Marks-lab/LOL-EVE" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "Marks-lab/LOL-EVE" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }' - Docker Model Runner
How to use Marks-lab/LOL-EVE with Docker Model Runner:
docker model run hf.co/Marks-lab/LOL-EVE
Upload folder using huggingface_hub
Browse files- README.md +170 -74
- gene_embeddings_v4.npz +3 -0
README.md
CHANGED
|
@@ -1,111 +1,207 @@
|
|
| 1 |
---
|
| 2 |
-
language:
|
| 3 |
-
- en
|
| 4 |
license: mit
|
| 5 |
-
|
| 6 |
-
-
|
| 7 |
-
|
| 8 |
-
|
| 9 |
-
|
| 10 |
-
|
| 11 |
-
|
| 12 |
-
|
| 13 |
-
|
| 14 |
-
|
| 15 |
-
|
| 16 |
-
|
| 17 |
-
|
| 18 |
-
- task:
|
| 19 |
-
type: variant-effect-prediction
|
| 20 |
-
name: Promoter Variant Effect Prediction
|
| 21 |
-
dataset:
|
| 22 |
-
type: eqtl_benchmark
|
| 23 |
-
name: Causal eQTL Identification
|
| 24 |
-
metrics:
|
| 25 |
-
- type: accuracy
|
| 26 |
-
value: "State-of-the-art"
|
| 27 |
-
name: Benchmark Performance
|
| 28 |
---
|
| 29 |
|
| 30 |
-
# LOL-EVE: Language
|
| 31 |
|
| 32 |
-
|
| 33 |
-
|
| 34 |
-
LOL-EVE is a conditional autoregressive transformer model trained on 14.6 million diverse mammalian promoter sequences. It leverages evolutionary information and proximal genetic context to predict indel variant effects in human promoter regions.
|
| 35 |
-
|
| 36 |
-
## Architecture
|
| 37 |
|
| 38 |
-
|
| 39 |
-
- **Base Architecture**: CTRL (Conditional Transformer Language Model)
|
| 40 |
-
- **Layers**: 12
|
| 41 |
-
- **Embedding Dimension**: 768
|
| 42 |
-
- **Attention Heads**: 12
|
| 43 |
-
- **Max Sequence Length**: 1007
|
| 44 |
-
- **Position Embedding**: adaptive
|
| 45 |
-
|
| 46 |
-
## Training Data
|
| 47 |
|
| 48 |
-
-
|
| 49 |
-
- **Species Coverage**: Diverse mammalian species
|
| 50 |
-
- **Sequence Length**: Up to 1000bp promoter regions
|
| 51 |
-
- **Embeddings**: Pre-trained protein embeddings (ESM)
|
| 52 |
|
| 53 |
-
##
|
| 54 |
|
| 55 |
-
|
| 56 |
-
|
| 57 |
-
|
| 58 |
-
|
|
|
|
| 59 |
|
| 60 |
## Usage
|
| 61 |
|
|
|
|
|
|
|
| 62 |
```python
|
| 63 |
from transformers import AutoTokenizer, AutoModelForCausalLM
|
| 64 |
|
| 65 |
-
# Load
|
| 66 |
-
tokenizer = AutoTokenizer.from_pretrained(
|
| 67 |
-
model = AutoModelForCausalLM.from_pretrained(
|
| 68 |
|
| 69 |
-
#
|
| 70 |
-
sequence = "ATGCTAGCTAGCTAGCTAGCTA"
|
| 71 |
inputs = tokenizer(sequence, return_tensors="pt")
|
|
|
|
|
|
|
|
|
|
|
|
|
| 72 |
|
| 73 |
-
|
|
|
|
|
|
|
|
|
|
| 74 |
outputs = model(**inputs)
|
| 75 |
```
|
| 76 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 77 |
## Citation
|
| 78 |
|
| 79 |
-
If you use
|
| 80 |
|
| 81 |
```bibtex
|
| 82 |
-
@article{
|
| 83 |
-
title={
|
| 84 |
author={[Authors]},
|
| 85 |
-
journal={
|
| 86 |
-
year={
|
| 87 |
}
|
| 88 |
```
|
| 89 |
|
| 90 |
## License
|
| 91 |
|
| 92 |
-
This model is
|
| 93 |
|
| 94 |
-
##
|
| 95 |
|
| 96 |
-
- **
|
| 97 |
-
- **
|
| 98 |
-
- **Learning Rate**: 3e-05
|
| 99 |
-
- **Weight Decay**: 0.01
|
| 100 |
-
- **Batch Size**: 16
|
| 101 |
-
- **Checkpoint**: model_epoch_epoch=01-val_all_control_perplexity_epoch=3.3182.ckpt
|
| 102 |
|
| 103 |
-
##
|
| 104 |
|
| 105 |
-
-
|
| 106 |
-
- Requires appropriate genomic context for optimal performance
|
| 107 |
-
- Performance may vary across different species and genomic regions
|
| 108 |
|
| 109 |
-
##
|
| 110 |
|
| 111 |
-
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
---
|
|
|
|
|
|
|
| 2 |
license: mit
|
| 3 |
+
tags:
|
| 4 |
+
- genomics
|
| 5 |
+
- dna
|
| 6 |
+
- language-model
|
| 7 |
+
- causal-lm
|
| 8 |
+
- biology
|
| 9 |
+
- sequence-modeling
|
| 10 |
+
- variant-prediction
|
| 11 |
+
- promoter
|
| 12 |
+
- indel
|
| 13 |
+
- eqtl
|
| 14 |
+
pipeline_tag: text-generation
|
| 15 |
+
library_name: transformers
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 16 |
---
|
| 17 |
|
| 18 |
+
# LOL-EVE: Language-Optimized Learning for Evolutionary Variant Effects
|
| 19 |
|
| 20 |
+
LOL-EVE is a state-of-the-art genomic language model designed for predicting the effects of DNA sequence variants, particularly in promoter regions. It combines pre-trained protein embeddings with a causal language modeling approach to understand the functional impact of genetic variations.
|
|
|
|
|
|
|
|
|
|
|
|
|
| 21 |
|
| 22 |
+
## Model Description
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 23 |
|
| 24 |
+
LOL-EVE is a transformer-based model that processes DNA sequences with control codes to predict variant effects. The model was trained on 13.6 million mammalian promoter sequences and demonstrates state-of-the-art performance on promoter indel prediction tasks.
|
|
|
|
|
|
|
|
|
|
| 25 |
|
| 26 |
+
### Key Features
|
| 27 |
|
| 28 |
+
- **Large vocabulary**: 39,378 tokens including DNA bases, control codes, and special tokens
|
| 29 |
+
- **Control code integration**: Incorporates gene, species, and clade information
|
| 30 |
+
- **Protein context**: Uses pre-trained ESM embeddings for gene-specific understanding
|
| 31 |
+
- **Flexible input format**: Supports both basic DNA sequences and control code sequences
|
| 32 |
+
- **Zero-shot prediction**: Enables prediction of indel effects without task-specific training
|
| 33 |
|
| 34 |
## Usage
|
| 35 |
|
| 36 |
+
### Basic Usage
|
| 37 |
+
|
| 38 |
```python
|
| 39 |
from transformers import AutoTokenizer, AutoModelForCausalLM
|
| 40 |
|
| 41 |
+
# Load model and tokenizer
|
| 42 |
+
tokenizer = AutoTokenizer.from_pretrained('Marks-lab/LOL-EVE')
|
| 43 |
+
model = AutoModelForCausalLM.from_pretrained('Marks-lab/LOL-EVE', trust_remote_code=True)
|
| 44 |
|
| 45 |
+
# Basic DNA sequence
|
| 46 |
+
sequence = "[MASK] [MASK] [MASK] [SOS]ATGCTAGCTAGCTAGCTAGCTA[EOS]"
|
| 47 |
inputs = tokenizer(sequence, return_tensors="pt")
|
| 48 |
+
outputs = model(**inputs)
|
| 49 |
+
```
|
| 50 |
+
|
| 51 |
+
### With Control Codes (Recommended)
|
| 52 |
|
| 53 |
+
```python
|
| 54 |
+
# Control code sequence (recommended)
|
| 55 |
+
control_sequence = "brca1 human primate [SOS] ATGCTAGCTAGCTAGCTAGCTA [EOS]"
|
| 56 |
+
inputs = tokenizer(control_sequence, return_tensors="pt")
|
| 57 |
outputs = model(**inputs)
|
| 58 |
```
|
| 59 |
|
| 60 |
+
### Variant Scoring
|
| 61 |
+
|
| 62 |
+
```python
|
| 63 |
+
import pandas as pd
|
| 64 |
+
import torch
|
| 65 |
+
|
| 66 |
+
def score_variants_hf(variants_df, gene, species, clade):
|
| 67 |
+
"""
|
| 68 |
+
Score variants using the Hugging Face model.
|
| 69 |
+
|
| 70 |
+
Args:
|
| 71 |
+
variants_df: DataFrame with columns ['sequence', 'variant_sequence']
|
| 72 |
+
gene: Gene name (e.g., 'brca1')
|
| 73 |
+
species: Species name (e.g., 'human')
|
| 74 |
+
clade: Clade information (e.g., 'primate')
|
| 75 |
+
|
| 76 |
+
Returns:
|
| 77 |
+
DataFrame with added 'score' column
|
| 78 |
+
"""
|
| 79 |
+
scores = []
|
| 80 |
+
|
| 81 |
+
for _, row in variants_df.iterrows():
|
| 82 |
+
# Create control code sequences
|
| 83 |
+
ref_seq = f"{gene} {species} {clade} [SOS] {row['sequence']} [EOS]"
|
| 84 |
+
var_seq = f"{gene} {species} {clade} [SOS] {row['variant_sequence']} [EOS]"
|
| 85 |
+
|
| 86 |
+
# Tokenize sequences
|
| 87 |
+
ref_inputs = tokenizer(ref_seq, return_tensors="pt")
|
| 88 |
+
var_inputs = tokenizer(var_seq, return_tensors="pt")
|
| 89 |
+
|
| 90 |
+
# Get model outputs
|
| 91 |
+
with torch.no_grad():
|
| 92 |
+
ref_outputs = model(**ref_inputs)
|
| 93 |
+
var_outputs = model(**var_inputs)
|
| 94 |
+
|
| 95 |
+
# Calculate log-likelihood scores
|
| 96 |
+
ref_logits = ref_outputs.logits[0, :-1] # Exclude last token
|
| 97 |
+
var_logits = var_outputs.logits[0, :-1]
|
| 98 |
+
|
| 99 |
+
ref_tokens = ref_inputs['input_ids'][0, 1:] # Exclude first token
|
| 100 |
+
var_tokens = var_inputs['input_ids'][0, 1:]
|
| 101 |
+
|
| 102 |
+
# Calculate sequence likelihood
|
| 103 |
+
ref_score = torch.nn.functional.cross_entropy(ref_logits, ref_tokens, reduction='sum')
|
| 104 |
+
var_score = torch.nn.functional.cross_entropy(var_logits, var_tokens, reduction='sum')
|
| 105 |
+
|
| 106 |
+
# Score is the difference (higher = more deleterious)
|
| 107 |
+
score = (var_score - ref_score).item()
|
| 108 |
+
scores.append(score)
|
| 109 |
+
|
| 110 |
+
variants_df['score'] = scores
|
| 111 |
+
return variants_df
|
| 112 |
+
|
| 113 |
+
# Example usage
|
| 114 |
+
variants = pd.DataFrame({
|
| 115 |
+
'sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA'],
|
| 116 |
+
'variant_sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA'] # Example variants
|
| 117 |
+
})
|
| 118 |
+
|
| 119 |
+
scored_variants = score_variants_hf(variants, gene='brca1', species='human', clade='primate')
|
| 120 |
+
print(scored_variants)
|
| 121 |
+
```
|
| 122 |
+
|
| 123 |
+
### Input Format
|
| 124 |
+
|
| 125 |
+
The model expects sequences in the format:
|
| 126 |
+
```
|
| 127 |
+
gene species clade [SOS] sequence [EOS]
|
| 128 |
+
```
|
| 129 |
+
|
| 130 |
+
Where:
|
| 131 |
+
- `gene`: Gene name (e.g., "brca1", "tp53")
|
| 132 |
+
- `species`: Species name (e.g., "human", "mouse")
|
| 133 |
+
- `clade`: Clade information (e.g., "primate", "mammal")
|
| 134 |
+
- `[SOS]`: Start of sequence token
|
| 135 |
+
- `sequence`: DNA sequence (A, T, G, C)
|
| 136 |
+
- `[EOS]`: End of sequence token
|
| 137 |
+
|
| 138 |
+
## Model Architecture
|
| 139 |
+
|
| 140 |
+
- **Model type**: Causal Language Model (CTRL-based)
|
| 141 |
+
- **Layers**: 12 transformer layers
|
| 142 |
+
- **Hidden size**: 768 dimensions
|
| 143 |
+
- **Attention heads**: 12
|
| 144 |
+
- **Vocabulary size**: 39,378 tokens
|
| 145 |
+
- **Max sequence length**: 1,007 tokens
|
| 146 |
+
- **Position embeddings**: Adaptive local position embeddings
|
| 147 |
+
|
| 148 |
+
## Training Data
|
| 149 |
+
|
| 150 |
+
The model was trained on genomic sequences with:
|
| 151 |
+
- DNA sequences up to 1000 base pairs
|
| 152 |
+
- Gene-specific control codes
|
| 153 |
+
- Species and clade information
|
| 154 |
+
- Pre-trained ESM protein embeddings
|
| 155 |
+
- 13.6 million mammalian promoter sequences
|
| 156 |
+
|
| 157 |
+
## Performance
|
| 158 |
+
|
| 159 |
+
LOL-EVE demonstrates state-of-the-art performance on:
|
| 160 |
+
|
| 161 |
+
### Benchmarks
|
| 162 |
+
- **Ultra-rare variant prioritization**: Prioritizing ultra-rare variants in gnomAD
|
| 163 |
+
- **Causal eQTL identification**: Identifying causal expression quantitative trait loci
|
| 164 |
+
- **Transcription factor binding site disruption**: Analyzing TFBS disruption by indels
|
| 165 |
+
|
| 166 |
+
### Key Results
|
| 167 |
+
- Superior performance compared to existing methods for promoter indel prediction
|
| 168 |
+
- Effective zero-shot prediction without task-specific training
|
| 169 |
+
- Strong cross-species generalization capabilities
|
| 170 |
+
|
| 171 |
+
## Datasets
|
| 172 |
+
|
| 173 |
+
- **[LOL-EVE-UltraRare](https://huggingface.co/datasets/Marks-lab/LOL-EVE-UltraRare)** - Ultra-rare variant benchmark dataset
|
| 174 |
+
- **[LOL-EVE-eQTL_benchmark](https://huggingface.co/datasets/Marks-lab/LOL-EVE-eQTL_benchmark)** - eQTL benchmark dataset
|
| 175 |
+
|
| 176 |
## Citation
|
| 177 |
|
| 178 |
+
If you use LOL-EVE in your research, please cite:
|
| 179 |
|
| 180 |
```bibtex
|
| 181 |
+
@article{loleve2025,
|
| 182 |
+
title={A Genomic Language Model for Zero-Shot Prediction of Promoter Variant Effects},
|
| 183 |
author={[Authors]},
|
| 184 |
+
journal={MLCB 2025},
|
| 185 |
+
year={2025}
|
| 186 |
}
|
| 187 |
```
|
| 188 |
|
| 189 |
## License
|
| 190 |
|
| 191 |
+
This model is released under the MIT License. See the [LICENSE](https://github.com/Marks-lab/LOL-EVE/blob/main/LICENSE) file for more details.
|
| 192 |
|
| 193 |
+
## Repository
|
| 194 |
|
| 195 |
+
- **GitHub**: [https://github.com/Marks-lab/LOL-EVE](https://github.com/Marks-lab/LOL-EVE)
|
| 196 |
+
- **Paper**: [MLCB 2025](https://github.com/Marks-lab/LOL-EVE) (link to be updated)
|
|
|
|
|
|
|
|
|
|
|
|
|
| 197 |
|
| 198 |
+
## Contact
|
| 199 |
|
| 200 |
+
For questions or issues, please contact [your-email@domain.com] or open an issue on the [GitHub repository](https://github.com/Marks-lab/LOL-EVE).
|
|
|
|
|
|
|
| 201 |
|
| 202 |
+
## Acknowledgments
|
| 203 |
|
| 204 |
+
- Built on the Hugging Face Transformers library
|
| 205 |
+
- Uses ESM protein embeddings for gene context
|
| 206 |
+
- Inspired by recent advances in genomic language modeling
|
| 207 |
+
- Trained on mammalian promoter sequences from multiple species
|
gene_embeddings_v4.npz
ADDED
|
@@ -0,0 +1,3 @@
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
+
version https://git-lfs.github.com/spec/v1
|
| 2 |
+
oid sha256:682e2c17b7b7709a9ea23283d691dcc155eb0ca24e4eda616d3e18011c693586
|
| 3 |
+
size 95669748
|